pENmRFPCNAL2 pc1054
(Plasmid #167567)

• Purpose: The fusion protein contains a SV40 NLS followed by mRFP, linker and human PCNA.
• Depositing Lab: Cristina Cardoso
• Publication: Sporbert et al Nucleic Acids Res. 2005 Jun 21;33(11):3521-8. doi: 10.1093/nar/gki665. Print 2005.

Backbone

• Vector backbone: pEVRF
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Proliferating Cell Nuclear Antigen
• Alt name: PCNA
• Species: H. sapiens (human)
• Entrez Gene: PCNA (a.k.a. ATLD2)
• Promoter: CMV
• Tag / Fusion Protein:
  • mRFP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: BsrGI (not destroyed)
• 5′ sequencing primer: AGCTGGACATCACCTCCCACAACG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry