Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pENmRFPCNAL2 pc1054
(Plasmid #167567)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 167567 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Proliferating Cell Nuclear Antigen
  • Alt name
    PCNA
  • Species
    H. sapiens (human)
  • Entrez Gene
    PCNA (a.k.a. ATLD2)
  • Promoter CMV
  • Tag / Fusion Protein
    • mRFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site BsrGI (not destroyed)
  • 5′ sequencing primer AGCTGGACATCACCTCCCACAACG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pENmRFPCNAL2 pc1054 was a gift from Cristina Cardoso (Addgene plasmid # 167567 ; http://n2t.net/addgene:167567 ; RRID:Addgene_167567)
  • For your References section:

    PCNA acts as a stationary loading platform for transiently interacting Okazaki fragment maturation proteins. Sporbert A, Domaing P, Leonhardt H, Cardoso MC. Nucleic Acids Res. 2005 Jun 21;33(11):3521-8. doi: 10.1093/nar/gki665. Print 2005. 10.1093/nar/gki665 PubMed 15972794