pET28b-bhaB7
(Plasmid
#167813)
-
PurposeExpresses His6-tagged BhaB7 in E. coli
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 167813 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepET28b
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5368
- Total vector size (bp) 7384
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBhaB7
-
SpeciesBacillus halodurans
-
Insert Size (bp)2471
-
GenBank IDBAB05766.1
- Promoter T7
-
Tag
/ Fusion Protein
- His6 (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28b-bhaB7 was a gift from Wilfred van der Donk (Addgene plasmid # 167813 ; http://n2t.net/addgene:167813 ; RRID:Addgene_167813) -
For your References section:
A biosynthetic pathway to aromatic amines that uses glycyl-tRNA as nitrogen donor. Daniels PN, Lee H, Splain RA, Ting CP, Zhu L, Zhao X, Moore BS, van der Donk WA. Nat Chem. 2022 Jan;14(1):71-77. doi: 10.1038/s41557-021-00802-2. Epub 2021 Nov 1. 10.1038/s41557-021-00802-2 PubMed 34725492