Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pET15b-bhaC1
(Plasmid #167814)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 167814 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pET15b
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5708
  • Total vector size (bp) 7727
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BhaC1
  • Species
    Bacillus halodurans
  • Insert Size (bp)
    2019
  • GenBank ID
    BAB05752.1
  • Promoter T7

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET15b-bhaC1 was a gift from Wilfred van der Donk (Addgene plasmid # 167814 ; http://n2t.net/addgene:167814 ; RRID:Addgene_167814)
  • For your References section:

    A biosynthetic pathway to aromatic amines that uses glycyl-tRNA as nitrogen donor. Daniels PN, Lee H, Splain RA, Ting CP, Zhu L, Zhao X, Moore BS, van der Donk WA. Nat Chem. 2022 Jan;14(1):71-77. doi: 10.1038/s41557-021-00802-2. Epub 2021 Nov 1. 10.1038/s41557-021-00802-2 PubMed 34725492