Skip to main content

pET28a-ammC1
(Plasmid #167816)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 167816 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET28a
  • Backbone manufacturer
    Twist Biosciences
  • Backbone size w/o insert (bp) 5369
  • Total vector size (bp) 7214
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AmmC1
  • Alt name
    AmmC1 codon optimized for E. coli expression
  • Species
    Synthetic
  • Insert Size (bp)
    1845
  • Promoter T7
  • Tag / Fusion Protein
    • His6 (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Twist Bioscience

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET28a-ammC1 was a gift from Wilfred van der Donk (Addgene plasmid # 167816 ; http://n2t.net/addgene:167816 ; RRID:Addgene_167816)
  • For your References section:

    A biosynthetic pathway to aromatic amines that uses glycyl-tRNA as nitrogen donor. Daniels PN, Lee H, Splain RA, Ting CP, Zhu L, Zhao X, Moore BS, van der Donk WA. Nat Chem. 2022 Jan;14(1):71-77. doi: 10.1038/s41557-021-00802-2. Epub 2021 Nov 1. 10.1038/s41557-021-00802-2 PubMed 34725492