pBLADE(FP6*)-mCherry
(Plasmid
#168048)
-
PurposeExpresses the synthetic gene BLADE FP6 under the constitutive J23101* promoter. mCherry expression is controlled by the PBAD promoter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 168048 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBAD33
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameBlue light-inducible AraC dimers in Escherichia coli
-
Alt nameBLADE
-
SpeciesSynthetic
-
Insert Size (bp)828
- Promoter J23101*
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer TCCCCATCGGTGATGTC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemCherry
-
SpeciesDiscosoma sp.
-
Insert Size (bp)708
- Promoter PBAD
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (not destroyed)
- 3′ cloning site HindIII (destroyed during cloning)
- 5′ sequencing primer ATGCCATAGCATTTTTATCC
- 3′ sequencing primer CTGATTTAATCTGTATCAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBLADE(FP6*)-mCherry was a gift from Barbara Di Ventura (Addgene plasmid # 168048 ; http://n2t.net/addgene:168048 ; RRID:Addgene_168048) -
For your References section:
Engineering AraC to make it responsive to light instead of arabinose. Romano E, Baumschlager A, Akmeric EB, Palanisamy N, Houmani M, Schmidt G, Ozturk MA, Ernst L, Khammash M, Di Ventura B. Nat Chem Biol. 2021 Apr 26. pii: 10.1038/s41589-021-00787-6. doi: 10.1038/s41589-021-00787-6. 10.1038/s41589-021-00787-6 PubMed 33903769