Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRECLV103_PGBD5_B
(Plasmid #168053)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 168053 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pReceiver-Lv103
  • Backbone manufacturer
    Genecopeia
  • Backbone size w/o insert (bp) 8721
  • Total vector size (bp) 10296
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PGBD5
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1575
  • GenBank ID
    NM_001258311.1
  • Entrez Gene
    PGBD5
  • Tag / Fusion Protein
    • GFP (N terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer agaacatggtggtgcagaca
  • 3′ sequencing primer TACAAGGTCCAGCCCTTCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRECLV103_PGBD5_B was a gift from Alex Kentsis (Addgene plasmid # 168053 ; http://n2t.net/addgene:168053 ; RRID:Addgene_168053)
  • For your References section:

    PGBD5 promotes site-specific oncogenic mutations in human tumors. Henssen AG, Koche R, Zhuang J, Jiang E, Reed C, Eisenberg A, Still E, MacArthur IC, Rodriguez-Fos E, Gonzalez S, Puiggros M, Blackford AN, Mason CE, de Stanchina E, Gonen M, Emde AK, Shah M, Arora K, Reeves C, Socci ND, Perlman E, Antonescu CR, Roberts CWM, Steen H, Mullen E, Jackson SP, Torrents D, Weng Z, Armstrong SA, Kentsis A. Nat Genet. 2017 May 15. doi: 10.1038/ng.3866. 10.1038/ng.3866 PubMed 28504702