Skip to main content

pAN7.1
(Plasmid #168129)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 168129 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC19
  • Backbone size w/o insert (bp) 2648
  • Total vector size (bp) 6749
  • Vector type
    Synthetic Biology
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    HygR gene
  • Alt name
    Hph
  • Species
    Synthetic; Aspergillus fumigatus
  • Insert Size (bp)
    4101
  • Promoter gdpA

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CAGGAAACAGCTATGACCATG
  • 3′ sequencing primer ACTGGCCGTCGTTTTACA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Peter Punt and Arthur Ram, obtained with permission from their original work in 1987.
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAN7.1 was a gift from Michael Bromley (Addgene plasmid # 168129)
  • For your References section:

    High-Throughput Gene Replacement in Aspergillus fumigatus. Zhao C, Fraczek MG, Dineen L, Lebedinec R, Macheleidt J, Heinekamp T, Delneri D, Bowyer P, Brakhage AA, Bromley M. Curr Protoc Microbiol. 2019 Sep;54(1):e88. doi: 10.1002/cpmc.88. 10.1002/cpmc.88 PubMed 31518064