Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAN7.1
(Plasmid #168129)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 168129 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUC19
  • Backbone size w/o insert (bp) 2648
  • Total vector size (bp) 6749
  • Vector type
    Synthetic Biology
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    HygR gene
  • Alt name
    Hph
  • Species
    Synthetic; Aspergillus fumigatus
  • Insert Size (bp)
    4101
  • Promoter gdpA

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CAGGAAACAGCTATGACCATG
  • 3′ sequencing primer ACTGGCCGTCGTTTTACA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Peter Punt and Arthur Ram, obtained with permission from their original work in 1987.
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAN7.1 was a gift from Michael Bromley (Addgene plasmid # 168129 ; http://n2t.net/addgene:168129 ; RRID:Addgene_168129)
  • For your References section:

    High-Throughput Gene Replacement in Aspergillus fumigatus. Zhao C, Fraczek MG, Dineen L, Lebedinec R, Macheleidt J, Heinekamp T, Delneri D, Bowyer P, Brakhage AA, Bromley M. Curr Protoc Microbiol. 2019 Sep;54(1):e88. doi: 10.1002/cpmc.88. 10.1002/cpmc.88 PubMed 31518064