pSP014
(Plasmid
#168224)
-
PurposeEatA protease expression plasmid
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 168224 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBAD-TOPO
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 4127
- Total vector size (bp) 8313
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameeatA
-
SpeciesE. coli
-
Insert Size (bp)4092
-
GenBank IDAY163491 AY163491
- Promoter araBAD
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer ATGCCATAGCATTTTTATCC
- 3′ sequencing primer ATTTAATCTGTATCAGGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSP014 was a gift from James Fleckenstein (Addgene plasmid # 168224 ; http://n2t.net/addgene:168224 ; RRID:Addgene_168224) -
For your References section:
Identification and molecular characterization of EatA, an autotransporter protein of enterotoxigenic Escherichia coli. Patel SK, Dotson J, Allen KP, Fleckenstein JM. Infect Immun. 2004 Mar;72(3):1786-94. doi: 10.1128/iai.72.3.1786-1794.2004. 10.1128/iai.72.3.1786-1794.2004 PubMed 14977988