pBAD-wtBlc
(Plasmid
#168255)
-
Purposewild‐type E. coli lipocalin Blc without signal peptide
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 168255 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBAD
- Backbone size w/o insert (bp) 3958
- Total vector size (bp) 4492
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameLipocalin Blc
-
SpeciesE. coli
-
Insert Size (bp)534
-
GenBank IDNC_000913.3
- Promoter araBAD
-
Tag
/ Fusion Protein
- His-tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer ATGCCATAGCATTTTTATCC
- 3′ sequencing primer GATTTAATCTGTATCAGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBAD-wtBlc was a gift from Jens Meiler (Addgene plasmid # 168255 ; http://n2t.net/addgene:168255 ; RRID:Addgene_168255) -
For your References section:
Lipocalin Blc is a potential heme-binding protein. Bozhanova NG, Calcutt MW, Beavers WN, Brown BP, Skaar EP, Meiler J. FEBS Lett. 2021 Jan;595(2):206-219. doi: 10.1002/1873-3468.14001. Epub 2020 Dec 3. 10.1002/1873-3468.14001 PubMed 33210733