pMRBad-Z-C-wtBlc
(Plasmid
#168256)
-
PurposeC-fragment. This plasmid can be co-transformed with either Plasmid 168258: pET11a-Z-N-wtBlc or Plasmid 168473: pET11a-Z-N-DiB2 to obtain wtBlc‐split-Zip or DiB2‐split-Zip protein, correspondingly
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 168256 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMRBad
- Backbone size w/o insert (bp) 4504
- Total vector size (bp) 4828
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameLeucine Zipper + C-fragment of wtBlc
-
SpeciesSynthetic
-
Insert Size (bp)324
- Promoter araBAD
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site BsrGI (not destroyed)
- 5′ sequencing primer GCACGGCGTCACACTTTGC
- 3′ sequencing primer CTAGTTATTGCTCAGCGGTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMRBad-Z-C-wtBlc was a gift from Jens Meiler (Addgene plasmid # 168256 ; http://n2t.net/addgene:168256 ; RRID:Addgene_168256) -
For your References section:
Lipocalin Blc is a potential heme-binding protein. Bozhanova NG, Calcutt MW, Beavers WN, Brown BP, Skaar EP, Meiler J. FEBS Lett. 2021 Jan;595(2):206-219. doi: 10.1002/1873-3468.14001. Epub 2020 Dec 3. 10.1002/1873-3468.14001 PubMed 33210733