pET11a-Z-N-wtBlc
(Plasmid
#168258)
-
PurposeN-fragment of the wtBlc‐split‐Zip protein. This plasmid needs to be co-transformed with Plasmid 168256: pMRBad-Z-C-wtBlc to obtain wtBlc‐split-Zip protein
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 168258 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET11a
- Backbone size w/o insert (bp) 5641
- Total vector size (bp) 6076
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameN-fragment of wtBlc + Leucine Zipper
-
SpeciesSynthetic
-
Insert Size (bp)435
- Promoter T7
-
Tag
/ Fusion Protein
- His-tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer CTAGTTATTGCTCAGCGGTG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET11a-Z-N-wtBlc was a gift from Jens Meiler (Addgene plasmid # 168258 ; http://n2t.net/addgene:168258 ; RRID:Addgene_168258) -
For your References section:
Lipocalin Blc is a potential heme-binding protein. Bozhanova NG, Calcutt MW, Beavers WN, Brown BP, Skaar EP, Meiler J. FEBS Lett. 2021 Jan;595(2):206-219. doi: 10.1002/1873-3468.14001. Epub 2020 Dec 3. 10.1002/1873-3468.14001 PubMed 33210733