Skip to main content

pET11a-Z-N-wtBlc
(Plasmid #168258)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 168258 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET11a
  • Backbone size w/o insert (bp) 5641
  • Total vector size (bp) 6076
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    N-fragment of wtBlc + Leucine Zipper
  • Species
    Synthetic
  • Insert Size (bp)
    435
  • Promoter T7
  • Tag / Fusion Protein
    • His-tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer CTAGTTATTGCTCAGCGGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET11a-Z-N-wtBlc was a gift from Jens Meiler (Addgene plasmid # 168258 ; http://n2t.net/addgene:168258 ; RRID:Addgene_168258)
  • For your References section:

    Lipocalin Blc is a potential heme-binding protein. Bozhanova NG, Calcutt MW, Beavers WN, Brown BP, Skaar EP, Meiler J. FEBS Lett. 2021 Jan;595(2):206-219. doi: 10.1002/1873-3468.14001. Epub 2020 Dec 3. 10.1002/1873-3468.14001 PubMed 33210733