pMRBad-Z-C-DiB-RM
(Plasmid
#168477)
-
PurposeC-fragment of the DiB-RM‐split‐Zip protein. This plasmid needs to be co-transformed with Plasmid 168475: pET11a-Z-N-DiB-RM to obtain DiB-RM‐split-Zip protein
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 168477 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMRBad
- Backbone size w/o insert (bp) 4504
- Total vector size (bp) 4828
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameLeucine Zipper + C-fragment of DiB-RM
-
SpeciesSynthetic
-
Insert Size (bp)324
- Promoter araBAD
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site BsrGI (not destroyed)
- 5′ sequencing primer GCACGGCGTCACACTTTGC
- 3′ sequencing primer CTAGTTATTGCTCAGCGGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMRBad-Z-C-DiB-RM was a gift from Jens Meiler (Addgene plasmid # 168477 ; http://n2t.net/addgene:168477 ; RRID:Addgene_168477) -
For your References section:
Computational redesign of a fluorogen activating protein with Rosetta. Bozhanova NG, Harp JM, Bender BJ, Gavrikov AS, Gorbachev DA, Baranov MS, Mercado CB, Zhang X, Lukyanov KA, Mishin AS, Meiler J. PLoS Comput Biol. 2021 Nov 8;17(11):e1009555. doi: 10.1371/journal.pcbi.1009555. eCollection 2021 Nov. 10.1371/journal.pcbi.1009555 PubMed 34748541