Skip to main content

pMRBad-Z-C-DiB-RM
(Plasmid #168477)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 168477 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMRBad
  • Backbone size w/o insert (bp) 4504
  • Total vector size (bp) 4828
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Leucine Zipper + C-fragment of DiB-RM
  • Species
    Synthetic
  • Insert Size (bp)
    324
  • Promoter araBAD

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site BsrGI (not destroyed)
  • 5′ sequencing primer GCACGGCGTCACACTTTGC
  • 3′ sequencing primer CTAGTTATTGCTCAGCGGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMRBad-Z-C-DiB-RM was a gift from Jens Meiler (Addgene plasmid # 168477 ; http://n2t.net/addgene:168477 ; RRID:Addgene_168477)
  • For your References section:

    Computational redesign of a fluorogen activating protein with Rosetta. Bozhanova NG, Harp JM, Bender BJ, Gavrikov AS, Gorbachev DA, Baranov MS, Mercado CB, Zhang X, Lukyanov KA, Mishin AS, Meiler J. PLoS Comput Biol. 2021 Nov 8;17(11):e1009555. doi: 10.1371/journal.pcbi.1009555. eCollection 2021 Nov. 10.1371/journal.pcbi.1009555 PubMed 34748541