Skip to main content

AAV-hRedOpsin-CD47
(Plasmid #168479)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 168479 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    AAV-MCS8
  • Backbone manufacturer
    Jeng-Shin Lee, Harvard University
  • Backbone size w/o insert (bp) 6079
  • Total vector size (bp) 7054
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    CD47
  • Alt name
    integrin associated protein
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    975
  • GenBank ID
    NM_010581.3
  • Entrez Gene
    Cd47 (a.k.a. 9130415E20Rik, B430305P08Rik, IAP, Itgp)
  • Promoter human red opsin

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site AgeI (not destroyed)
  • 5′ sequencing primer gtgtagggtttgggagcttt
  • 3′ sequencing primer tccgctggattgagggccgaa
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-hRedOpsin-CD47 was a gift from Connie Cepko (Addgene plasmid # 168479)
  • For your References section:

    Augmentation of CD47/SIRPalpha signaling protects cones in genetic models of retinal degeneration. Wang SK, Xue Y, Cepko CL. JCI Insight. 2021 Aug 23;6(16). pii: e150796. doi: 10.1172/jci.insight.150796. 10.1172/jci.insight.150796 PubMed 34197341