AAV-hRedOpsin-CD47
(Plasmid
#168479)
-
PurposeAAV plasmid expressing CD47 in photoreceptors
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 168479 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneAAV-MCS8
-
Backbone manufacturerJeng-Shin Lee, Harvard University
- Backbone size w/o insert (bp) 6079
- Total vector size (bp) 7054
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCD47
-
Alt nameintegrin associated protein
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)975
-
GenBank IDNM_010581.3
-
Entrez GeneCd47 (a.k.a. 9130415E20Rik, B430305P08Rik, IAP, Itgp)
- Promoter human red opsin
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site AgeI (not destroyed)
- 5′ sequencing primer gtgtagggtttgggagcttt
- 3′ sequencing primer tccgctggattgagggccgaa
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-hRedOpsin-CD47 was a gift from Connie Cepko (Addgene plasmid # 168479) -
For your References section:
Augmentation of CD47/SIRPalpha signaling protects cones in genetic models of retinal degeneration. Wang SK, Xue Y, Cepko CL. JCI Insight. 2021 Aug 23;6(16). pii: e150796. doi: 10.1172/jci.insight.150796. 10.1172/jci.insight.150796 PubMed 34197341