Tol2-aACry::EGFP-zebrafish Plaat1 (WT)
(Plasmid
#168772)
-
PurposeExpress EGFP-zebrafish Plaat1 (WT) in zebrafish lens
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 168772 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneTol2-aACry
- Total vector size (bp) 5733
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHrasls
-
Alt nameplaat1
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)539
-
Entrez Geneplaat1 (a.k.a. h, hrasls, zgc:92715)
- Promoter alphaA-crystallin promoter
-
Tag
/ Fusion Protein
- EGFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site ClaI (not destroyed)
- 3′ cloning site BlnI (not destroyed)
- 5′ sequencing primer TACCAGGTCTGACAGATCTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Tol2-aACry::EGFP-zebrafish Plaat1 (WT) was a gift from Noboru Mizushima (Addgene plasmid # 168772 ; http://n2t.net/addgene:168772 ; RRID:Addgene_168772) -
For your References section:
Organelle degradation in the lens by PLAAT phospholipases. Morishita H, Eguchi T, Tsukamoto S, Sakamaki Y, Takahashi S, Saito C, Koyama-Honda I, Mizushima N. Nature. 2021 Apr;592(7855):634-638. doi: 10.1038/s41586-021-03439-w. Epub 2021 Apr 14. 10.1038/s41586-021-03439-w PubMed 33854238