Skip to main content

Tol2-aACry::EGFP-zebrafish Plaat1 (WT)
(Plasmid #168772)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 168772 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Tol2-aACry
  • Total vector size (bp) 5733

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Hrasls
  • Alt name
    plaat1
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
    539
  • Entrez Gene
    plaat1 (a.k.a. h, hrasls, zgc:92715)
  • Promoter alphaA-crystallin promoter
  • Tag / Fusion Protein
    • EGFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site ClaI (not destroyed)
  • 3′ cloning site BlnI (not destroyed)
  • 5′ sequencing primer TACCAGGTCTGACAGATCTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Tol2-aACry::EGFP-zebrafish Plaat1 (WT) was a gift from Noboru Mizushima (Addgene plasmid # 168772 ; http://n2t.net/addgene:168772 ; RRID:Addgene_168772)
  • For your References section:

    Organelle degradation in the lens by PLAAT phospholipases. Morishita H, Eguchi T, Tsukamoto S, Sakamaki Y, Takahashi S, Saito C, Koyama-Honda I, Mizushima N. Nature. 2021 Apr;592(7855):634-638. doi: 10.1038/s41586-021-03439-w. Epub 2021 Apr 14. 10.1038/s41586-021-03439-w PubMed 33854238