Skip to main content

pBAD-DiB1
(Plasmid #168800)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 168800 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBAD
  • Backbone size w/o insert (bp) 3958
  • Total vector size (bp) 4492
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Fluorogen activating protein DiB1
  • Species
    Synthetic
  • Insert Size (bp)
    534
  • GenBank ID
  • Promoter araBAD
  • Tag / Fusion Protein
    • His-tag (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer ATGCCATAGCATTTTTATCC
  • 3′ sequencing primer GATTTAATCTGTATCAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBAD-DiB1 was a gift from Alexander Mishin (Addgene plasmid # 168800 ; http://n2t.net/addgene:168800 ; RRID:Addgene_168800)
  • For your References section:

    Protein labeling for live cell fluorescence microscopy with a highly photostable renewable signal. Bozhanova NG, Baranov MS, Klementieva NV, Sarkisyan KS, Gavrikov AS, Yampolsky IV, Zagaynova EV, Lukyanov SA, Lukyanov KA, Mishin AS. Chem Sci. 2017 Oct 1;8(10):7138-7142. doi: 10.1039/c7sc01628j. Epub 2017 Aug 3. 10.1039/c7sc01628j PubMed 29147545