TagBFP-DiB2-splitN1–125
(Plasmid
#168973)
-
PurposeN-fragment of the DiB2‐split protein fused with blue fluorescent protein TagBFP
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 168973 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepICH47732
- Backbone size w/o insert (bp) 5296
- Total vector size (bp) 6346
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTagBFP - DiB2-split N-frag
-
SpeciesSynthetic
-
Insert Size (bp)1050
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BpiI (not destroyed)
- 3′ cloning site BpiI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CAAGTTAACAACAACAATTGCAT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TagBFP-DiB2-splitN1–125 was a gift from Jens Meiler (Addgene plasmid # 168973 ; http://n2t.net/addgene:168973 ; RRID:Addgene_168973) -
For your References section:
DiB-splits: nature-guided design of a novel fluorescent labeling split system. Bozhanova NG, Gavrikov AS, Mishin AS, Meiler J. Sci Rep. 2020 Jul 6;10(1):11049. doi: 10.1038/s41598-020-67095-2. 10.1038/s41598-020-67095-2 PubMed 32632329