pFL GST-UBXN2A
(Plasmid
#169016)
-
PurposeExpresses GST-UBXN2A (human) in insect cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 169016 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepFL
- Backbone size w/o insert (bp) 5385
- Total vector size (bp) 6858
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameUBXN2A
-
Alt nameUBXD4
-
SpeciesH. sapiens (human)
-
Insert Size (bp)777
-
GenBank IDNP_859064.2
-
Entrez GeneUBXN2A (a.k.a. UBXD4)
- Promoter polyhedrin promoter
-
Tag
/ Fusion Protein
- GST (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer TAAAATGATAACCATCTCGC
- 3′ sequencing primer GAGGTTTTACTTGCTTTAAA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFL GST-UBXN2A was a gift from Hemmo Meyer (Addgene plasmid # 169016 ; http://n2t.net/addgene:169016 ; RRID:Addgene_169016) -
For your References section:
Protein Phosphatase-1 Complex Disassembly by p97 is Initiated through Multivalent Recognition of Catalytic and Regulatory Subunits by the p97 SEP-domain Adapters. Kracht M, van den Boom J, Seiler J, Kroning A, Kaschani F, Kaiser M, Meyer H. J Mol Biol. 2020 Nov 20;432(23):6061-6074. doi: 10.1016/j.jmb.2020.10.001. Epub 2020 Oct 12. 10.1016/j.jmb.2020.10.001 PubMed 33058883