Skip to main content

pME-mCherry-PA-Rac1
(Plasmid #169042)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 169042 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pENTR/D-TOPO
  • Backbone manufacturer
    ThermoFischer
  • Backbone size w/o insert (bp) 2709
  • Total vector size (bp) 4449
  • Vector type
    Gateway Entry Cloning Vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PA-Rac-1
  • Alt name
    Photoactivatable Rac1
  • Alt name
    LOV(Leu404-Leu546)-(L514K-L531K)-Rac1(Ile4)-Q61L/E91H/N92H
  • Species
    H. sapiens (human); Avena sativa (oat)
  • Insert Size (bp)
    1005
  • Mutation
    Rac1 starts at I4 and contains mutations Q61L, E91H and N92H (results in the photoactivatable analogue of Rac1). L514K, L531K mutations in LOV domain reduce background activation.
  • GenBank ID
    AB451363
  • Entrez Gene
    RAC1 (a.k.a. MIG5, MRD48, Rac-1, TC-25, p21-Rac1)
  • Tags / Fusion Proteins
    • Fused with mCherry (N terminal on backbone)
    • 6X His (N terminal on backbone)

Cloning Information

  • Cloning method TOPO Cloning
  • 5′ sequencing primer GTAAAACGACGGCCAG
  • 3′ sequencing primer CATCAGAGATTTTGAGACAC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Addgene 22027

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pME-mCherry-PA-Rac1 was a gift from Paola Arlotta (Addgene plasmid # 169042 ; http://n2t.net/addgene:169042 ; RRID:Addgene_169042)
  • For your References section:

    Long-Range Optogenetic Control of Axon Guidance Overcomes Developmental Boundaries and Defects. Harris JM, Wang AY, Boulanger-Weill J, Santoriello C, Foianini S, Lichtman JW, Zon LI, Arlotta P. Dev Cell. 2020 Jun 8;53(5):577-588.e7. doi: 10.1016/j.devcel.2020.05.009. 10.1016/j.devcel.2020.05.009 PubMed 32516597