Skip to main content
Addgene

p5E-3x125bp-mnx1
(Plasmid #169043)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 169043 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    p5E
  • Backbone manufacturer
    Chi-Bin Chien lab
  • Backbone size w/o insert (bp) 2663
  • Total vector size (bp) 3091
  • Vector type
    Gateway Entry Cloning Vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Mnx1 enhancer (3x)
  • Alt name
    Three tandem repeats of zebrafish mnx1 enhancer
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
    411
  • Entrez Gene
    mnx1 (a.k.a. hlxb, hlxb9, zgc:112174)
  • Promoter 3xMnx1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site HindIII (destroyed during cloning)
  • 5′ sequencing primer GTAAAACGACGGCCAG
  • 3′ sequencing primer CATCAGAGATTTTGAGACAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

See the following paper for cloning details of the 3x 125bp mnx1 enhancer: Zelenchuk, T.A. and Brusés, J.L. (2011), In Vivo labeling of zebrafish motor neurons using an mnx1 enhancer and Gal4/UAS. Genesis, 49: 546-554. https://doi.org/10.1002/dvg.20766

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p5E-3x125bp-mnx1 was a gift from Paola Arlotta (Addgene plasmid # 169043 ; http://n2t.net/addgene:169043 ; RRID:Addgene_169043)
  • For your References section:

    Long-Range Optogenetic Control of Axon Guidance Overcomes Developmental Boundaries and Defects. Harris JM, Wang AY, Boulanger-Weill J, Santoriello C, Foianini S, Lichtman JW, Zon LI, Arlotta P. Dev Cell. 2020 Jun 8;53(5):577-588.e7. doi: 10.1016/j.devcel.2020.05.009. 10.1016/j.devcel.2020.05.009 PubMed 32516597