p5E-3x125bp-mnx1
(Plasmid
#169043)
-
Purpose5' entry vector for Gateway cloning for expression in spinal motor neurons using 3 tandem repeats of the zebrafish mnx1 enhancer.
-
Depositing Lab
-
Depositing OrganizationHarvard University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 169043 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonep5E
-
Backbone manufacturerChi-Bin Chien lab
- Backbone size w/o insert (bp) 2663
- Total vector size (bp) 3091
-
Vector typeGateway Entry Cloning Vector
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMnx1 enhancer (3x)
-
Alt nameThree tandem repeats of zebrafish mnx1 enhancer
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)411
-
Entrez Genemnx1 (a.k.a. hlxb, hlxb9, zgc:112174)
- Promoter 3xMnx1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site HindIII (destroyed during cloning)
- 5′ sequencing primer GTAAAACGACGGCCAG
- 3′ sequencing primer CATCAGAGATTTTGAGACAC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
See the following paper for cloning details of the 3x 125bp mnx1 enhancer: Zelenchuk, T.A. and Brusés, J.L. (2011), In Vivo labeling of zebrafish motor neurons using an mnx1 enhancer and Gal4/UAS. Genesis, 49: 546-554. https://doi.org/10.1002/dvg.20766
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p5E-3x125bp-mnx1 was a gift from Paola Arlotta (Addgene plasmid # 169043 ; http://n2t.net/addgene:169043 ; RRID:Addgene_169043) -
For your References section:
Long-Range Optogenetic Control of Axon Guidance Overcomes Developmental Boundaries and Defects. Harris JM, Wang AY, Boulanger-Weill J, Santoriello C, Foianini S, Lichtman JW, Zon LI, Arlotta P. Dev Cell. 2020 Jun 8;53(5):577-588.e7. doi: 10.1016/j.devcel.2020.05.009. 10.1016/j.devcel.2020.05.009 PubMed 32516597