Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

SNAP-Rab5
(Plasmid #169069)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 169069 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSNAPf-C1
  • Backbone manufacturer
    Michael Davidson
  • Backbone size w/o insert (bp) 4560
  • Total vector size (bp) 5169
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Rab5B
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    652
  • GenBank ID
    NM_002868.3
  • Entrez Gene
    RAB5B
  • Promoter CMV
  • Tag / Fusion Protein
    • SNAP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CAAATGTGGTATGGCTGATT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note: Plasmid contains differences in the linker region between SNAP and Rab5B compared to the depositor's sequence. These differences do not affect the plasmid's functions.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SNAP-Rab5 was a gift from Gia Voeltz (Addgene plasmid # 169069 ; http://n2t.net/addgene:169069 ; RRID:Addgene_169069)
  • For your References section:

    Reticulon-3 Promotes Endosome Maturation at ER Membrane Contact Sites. Wu H, Voeltz GK. Dev Cell. 2021 Jan 11;56(1):52-66.e7. doi: 10.1016/j.devcel.2020.12.014. 10.1016/j.devcel.2020.12.014 PubMed 33434526