Skip to main content

pNB204
(Plasmid #169115)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 169115 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pNB200
  • Backbone size w/o insert (bp) 2400
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    6xHis-alr
  • Species
    Synthetic; Mycobacterium tuberculosis H37Rv
  • Insert Size (bp)
    1173
  • Mutation
    Codon optimized for E. coli
  • Entrez Gene
    alr (a.k.a. Rv3423c)
  • Promoter pBAD
  • Tag / Fusion Protein
    • 6xHis (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer GATTAGCGGATCCTACCTGACG
  • 3′ sequencing primer AGGCCCAGTCTTTCGACTGAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2021.03.26.437171 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNB204 was a gift from Edwin Wintermute (Addgene plasmid # 169115 ; http://n2t.net/addgene:169115 ; RRID:Addgene_169115)
  • For your References section:

    Low-cost anti-mycobacterial drug discovery using engineered E. coli. Bongaerts N, Edoo Z, Abukar AA, Song X, Sosa-Carrillo S, Haggenmueller S, Savigny J, Gontier S, Lindner AB, Wintermute EH. Nat Commun. 2022 Jul 7;13(1):3905. doi: 10.1038/s41467-022-31570-3. 10.1038/s41467-022-31570-3 PubMed 35798732