Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Equalizer-H plasmid
(Plasmid #169367)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 169367 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA5/FRT
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 6113
  • Total vector size (bp) 7978
  • Modifications to backbone
    TetO2 site and rabbit beta-globin intron II (bGlob intron) are added to the 5' UTR. Woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) is added to the 3' UTR.
  • Vector type
    Mammalian Expression, Synthetic Biology
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    tetR-P2A-eGFP-miR(FF3) target-miR(FF3)
  • Species
    Synthetic
  • Insert Size (bp)
    1865
  • Promoter pCMV-tetO2

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer cgcaaatgggcggtaggcgtg
  • 3′ sequencing primer tagaaggcacagtcgagg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note that although the plasmid encodes a hygromycin resistance gene, it is not expressed from the plasmid. It is only expressed after Flp recombinase-mediated chromosomal integration of the plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Equalizer-H plasmid was a gift from Francois St-Pierre (Addgene plasmid # 169367 ; http://n2t.net/addgene:169367 ; RRID:Addgene_169367)
  • For your References section:

    A synthetic circuit for buffering gene dosage variation between individual mammalian cells. Yang J, Lee J, Land MA, Lai S, Igoshin OA, St-Pierre F. Nat Commun. 2021 Jul 5;12(1):4132. doi: 10.1038/s41467-021-23889-0. 10.1038/s41467-021-23889-0 PubMed 34226556