Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSUB7
(Plasmid #169698)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 169698 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSU311
  • Backbone manufacturer
    Uzzau et al (PubMed 11742086). Note, pSU311 was initially derived from pGP704 (Miller & Mekalanos; PubMed 2836362)
  • Backbone size w/o insert (bp) 1932
  • Total vector size (bp) 3440
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    cc118 lambda pir
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    6xHis epitope tag adjacent to FRT-flanked aph (KanR) gene
  • Species
    E.coli and partially synthetic
  • Insert Size (bp)
    1508
  • Tag / Fusion Protein
    • 6xHis tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer AGGGATGTAACGCACTGAGA
  • 3′ sequencing primer CCTGCAGATCATCGAGCTCT
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    B. Wanner. The FRT-flanked aph (KanR) cassette was derived from plasmid pKD4 (Datsenko & Wanner, PubMed 10829079)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The 6xHis-FRT-aph-FRT segment is amplified by PCR with primers ending with the sequences 5'...CACCACCATCATCACCATTAG-3' (Forward primer) and 5'...CATATGAATATCCTCCTTAG-3' (Reverse primer) and carrying 40 nt 5' extensions identical to the sequence immediately preceding the stop codon of the targeted gene (Fw primer) and to a region downstream from it (Rv primer). The amplified fragment is used for DNA recombineering in a strain expressing the Lambda Red operon.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSUB7 was a gift from Nara Figueroa (Addgene plasmid # 169698 ; http://n2t.net/addgene:169698 ; RRID:Addgene_169698)
  • For your References section:

    Epitope tagging of chromosomal genes in Salmonella. Uzzau S, Figueroa-Bossi N, Rubino S, Bossi L. Proc Natl Acad Sci U S A. 2001 Dec 18;98(26):15264-9. doi: 10.1073/pnas.261348198. Epub 2001 Dec 11. 10.1073/pnas.261348198 PubMed 11742086