Skip to main content

Grin1 gRNA#2
(Plasmid #169790)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 169790 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    gRNA backbone
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Grin1
  • gRNA/shRNA sequence
    GTACGGTGCGAAGGAAGCTCAGG
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Grin1 (a.k.a. GluN1, GluRdelta1, GluRzeta1, M100174, NMD-R1, NMDAR1, NR1, Nmdar, Rgsc174)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Grin1 gRNA#2 was a gift from Takeshi Imai (Addgene plasmid # 169790 ; http://n2t.net/addgene:169790 ; RRID:Addgene_169790)
  • For your References section:

    BMPR-2 gates activity-dependent stabilization of primary dendrites during mitral cell remodeling. Aihara S, Fujimoto S, Sakaguchi R, Imai T. Cell Rep. 2021 Jun 22;35(12):109276. doi: 10.1016/j.celrep.2021.109276. 10.1016/j.celrep.2021.109276 PubMed 34161760