pLKO.1P shACO1
(Plasmid
#169884)
-
PurposeSuppress ACO1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 169884 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLKO.1p
-
Backbone manufacturerBroad Institute
- Backbone size w/o insert (bp) 7200
- Total vector size (bp) 7200
-
Vector typeLentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameshRNA against ACO1
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)21
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
TRCN0000056553 - CCAGGAAAGAAATTCTTCAAT
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.1P shACO1 was a gift from Richard Possemato (Addgene plasmid # 169884 ; http://n2t.net/addgene:169884 ; RRID:Addgene_169884) -
For your References section:
Iron-sulfur cluster deficiency can be sensed by IRP2 and regulates iron homeostasis and sensitivity to ferroptosis independent of IRP1 and FBXL5. Terzi EM, Sviderskiy VO, Alvarez SW, Whiten GC, Possemato R. Sci Adv. 2021 May 26;7(22). pii: 7/22/eabg4302. doi: 10.1126/sciadv.abg4302. Print 2021 May. 10.1126/sciadv.abg4302 PubMed 34039609