Ecm2 1-265
(Plasmid
#169925)
-
PurposeWT Ecm2 mutated to introduce stop codon after AA 265 of Ecm2
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 169925 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRS416
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 5000
- Total vector size (bp) 6500
-
Vector typeBacterial Expression, Yeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameEcm2 1-265
-
Alt nameI266St ECM2 URA
-
Alt namepAAH1196
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)1500
-
GenBank ID
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer TAATAGTAAAGTGAGACACTTGTCAC
- 3′ sequencing primer TTTACTGACAAACCGCTCC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Ecm2 1-265 was a gift from Aaron Hoskins (Addgene plasmid # 169925 ; http://n2t.net/addgene:169925 ; RRID:Addgene_169925) -
For your References section:
Saccharomyces cerevisiae Ecm2 Modulates the Catalytic Steps of pre-mRNA Splicing. van der Feltz C, Nikolai B, Schneider C, Paulson JC, Fu X, Hoskins AA. RNA. 2021 Feb 5. pii: rna.077727.120. doi: 10.1261/rna.077727.120. 10.1261/rna.077727.120 PubMed 33547186