pAM003
(Plasmid
#170007)
-
PurposeEncodes PmgtC-sfgfp reporter and TetR-controlled expression of S. Typhimurium PhoP
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 170007 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSC101*
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameSuperfolder GFP
-
Alt namesfgfp
-
SpeciesAequorea victoria
- Promoter PmgtC
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer CGTCTAAGAAACCATTATTATCATGACATTAAC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namePhoP
-
SpeciesSalmonella enterica subsp. enterica serovar Typhimurium
- Promoter PLTetO-1
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer GAGTTTACGGGTTGTTAAACCTTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2021.06.01.446581v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAM003 was a gift from Jeffrey Tabor (Addgene plasmid # 170007 ; http://n2t.net/addgene:170007 ; RRID:Addgene_170007) -
For your References section:
High-throughput discovery of peptide activators of a bacterial sensor kinase. Brink KR, Mu AM, Hoang KV, Groszman K, Gunn JS, Tabor JJ. bioRxiv 10.1101/2021.06.01.446581