pKB233
(Plasmid
#170040)
-
PurposeEncodes PvirK-mNeonGreen reporter
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 170040 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSC101*
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namemNeonGreen
-
SpeciesBranchiostoma lanceolatum
- Promoter PvirK
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CGTCTAAGAAACCATTATTATCATGACATTAAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2021.06.01.446581v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKB233 was a gift from Jeffrey Tabor (Addgene plasmid # 170040 ; http://n2t.net/addgene:170040 ; RRID:Addgene_170040) -
For your References section:
High-throughput discovery of peptide activators of a bacterial sensor kinase. Brink KR, Mu AM, Hoang KV, Groszman K, Gunn JS, Tabor JJ. bioRxiv 10.1101/2021.06.01.446581