pEc-crRNA1
(Plasmid
#170088)
-
Purposeencodes E. coli type I-E single spacer array
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 170088 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneColE1
- Backbone size w/o insert (bp) 1688
- Total vector size (bp) 1852
-
Vector typeCRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameE. coli type I-E single spacer array
-
gRNA/shRNA sequenceAATTCTGGCGAATCCTTTAATTAACTGACCAG
- Promoter J23119
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CACCTCTGACTTGAGCGTCG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEc-crRNA1 was a gift from Chase Beisel (Addgene plasmid # 170088 ; http://n2t.net/addgene:170088 ; RRID:Addgene_170088) -
For your References section:
A TXTL-Based Assay to Rapidly Identify PAMs for CRISPR-Cas Systems with Multi-Protein Effector Complexes. Wimmer F, Englert F, Beisel CL. Methods Mol Biol. 2022;2433:391-411. doi: 10.1007/978-1-0716-1998-8_24. 10.1007/978-1-0716-1998-8_24 PubMed 34985758