pGFP-GTAAT
(Plasmid
#170098)
-
PurposedeGFP reporter plasmid with GTAAT PAM upstream of p70a promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 170098 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBEST
- Backbone size w/o insert (bp) 2400
- Total vector size (bp) 3210
-
Modifications to backboneInsertion of a GTAAT sequence upstream of the promoter driving deGFP expression. Insertion of a unique PacI restriction enzyme recognition site upstream of the degfp gene.
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)KL740 cI857+
-
Growth instructions29°C
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedeGFP
-
SpeciesSynthetic
-
Insert Size (bp)678
- Promoter p70a
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ACCGCCGCAGAGTGGATGTTTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGFP-GTAAT was a gift from Chase Beisel (Addgene plasmid # 170098 ; http://n2t.net/addgene:170098 ; RRID:Addgene_170098) -
For your References section:
A TXTL-Based Assay to Rapidly Identify PAMs for CRISPR-Cas Systems with Multi-Protein Effector Complexes. Wimmer F, Englert F, Beisel CL. Methods Mol Biol. 2022;2433:391-411. doi: 10.1007/978-1-0716-1998-8_24. 10.1007/978-1-0716-1998-8_24 PubMed 34985758