MS2-adRNA (3'GAC)
(Plasmid
#170129)
-
PurposeLentiviral vector carrying 2 copies of the MS2 adRNA targeting a GAC at the 3' end of the ADAR2 deaminase domain in plasmids #170124 and 170125
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 170129 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonelentiCRISPR v2
-
Backbone manufacturerAddgene #52961
- Backbone size w/o insert (bp) 10500
- Total vector size (bp) 12300
-
Modifications to backbone1 copy of the MS2-adRNA cloned downstream of the human U6 promoter followed by a mouse U6 promoter that drives the expression of a second copy. mCherry-P2A-Hygromycin cloned in place of the Cas9-P2A-Puromycin in the original vector.
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMS2-ADAR2(3'GAC)-MS2
-
gRNA/shRNA sequenceaACATGAGGATCACCCATGTcGCACAGCCTGCTGGCTCTTCaACATGAGGATCACCCATGTc
-
SpeciesH. sapiens (human)
- Promoter Human U6 and mouse U6
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GACTATCATATGCTTACCGT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MS2-adRNA (3'GAC) was a gift from Prashant Mali (Addgene plasmid # 170129 ; http://n2t.net/addgene:170129 ; RRID:Addgene_170129) -
For your References section:
Comprehensive interrogation of the ADAR2 deaminase domain for engineering enhanced RNA editing activity and specificity. Katrekar D, Xiang Y, Palmer N, Saha A, Meluzzi D, Mali P. Elife. 2022 Jan 19;11. pii: 75555. doi: 10.7554/eLife.75555. 10.7554/eLife.75555 PubMed 35044296