pTRIP-SFFV-Hygro-2A-TMRPSS2
(Plasmid
#170390)
-
PurposeGeneration of stable lines to enhance SARS-CoV-2 infectivity in ACE2 expressing cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 170390 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepTRIP
- Backbone size w/o insert (bp) 10738
- Total vector size (bp) 12217
-
Vector typeLentiviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTMPRSS2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1479
-
GenBank IDNM_005656.4
-
Entrez GeneTMPRSS2 (a.k.a. PRSS10)
- Promoter SFFV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTGTCGGGCGTACACAAATC
- 3′ sequencing primer tagccaggcacaatcagcat
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTRIP-SFFV-Hygro-2A-TMRPSS2 was a gift from Nir Hacohen (Addgene plasmid # 170390 ; http://n2t.net/addgene:170390 ; RRID:Addgene_170390) -
For your References section:
Longitudinal proteomic analysis of severe COVID-19 reveals survival-associated signatures, tissue-specific cell death, and cell-cell interactions. Filbin MR, Mehta A, Schneider AM, Kays KR, Guess JR, Gentili M, Fenyves BG, Charland NC, Gonye ALK, Gushterova I, Khanna HK, LaSalle TJ, Lavin-Parsons KM, Lilley BM, Lodenstein CL, Manakongtreecheep K, Margolin JD, McKaig BN, Rojas-Lopez M, Russo BC, Sharma N, Tantivit J, Thomas MF, Gerszten RE, Heimberg GS, Hoover PJ, Lieb DJ, Lin B, Ngo D, Pelka K, Reyes M, Smillie CS, Waghray A, Wood TE, Zajac AS, Jennings LL, Grundberg I, Bhattacharyya RP, Parry BA, Villani AC, Sade-Feldman M, Hacohen N, Goldberg MB. Cell Rep Med. 2021 May 18;2(5):100287. doi: 10.1016/j.xcrm.2021.100287. Epub 2021 May 3. 10.1016/j.xcrm.2021.100287 PubMed 33969320