LentiGuide Cherry
(Plasmid #170510)

• Purpose: Expresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and mCherry marker from EF-1a promoter. 3rd generation lentiviral backbone.
• Depositing Lab: Pavel Tolar
• Publication: Newman et al biorXiv 2021.03.02.433398

Backbone

• Vector backbone: lentiGuide-Puro
• Backbone manufacturer: Feng Zhang lab (Addgene plasmid #52963)
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: mCherry

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: S. pyogenes sgRNA cassette
• Alt name: S. pyogenes CRISPR customizable RNA element
• Species: Synthetic
• Insert Size (bp): 100
• Promoter: hU6

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsmBI (not destroyed)
• 3′ cloning site: BsmBI (not destroyed)
• 5′ sequencing primer: ACTATCATATGCTTACCGTAAC

Gene/Insert 2

• Gene/Insert name: mCherry
• Species: Synthetic
• Insert Size (bp): 698
• Promoter: EF-1a

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsiWI (not destroyed)
• 3′ cloning site: MluI (not destroyed)
• 5′ sequencing primer: tggttcattctcaagcctcag

Resource Information

• A portion of this plasmid was derived from a plasmid made by: CRISPR cassette generated by Feng Zhang
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Plasmid based on lentiGuide Puro (addgene plasmid #52963).

Please visit https://www.biorxiv.org/content/10.1101/2021.03.02.433398v1 for bioRxiv preprint.