Skip to main content

pQlinkH-PTPIP51(236-470)
(Plasmid #170530)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 170530 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pQlinkH
  • Backbone manufacturer
    Addgene
  • Backbone size w/o insert (bp) 4901
  • Total vector size (bp) 5606
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Protein tyrosine phosphatase interacting protein 51 (236-470)
  • Alt name
    Regulator of microtubule dynamics protein 3
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    705
  • Entrez Gene
    RMDN3 (a.k.a. FAM82A2, FAM82C, RMD-3, RMD3, ptpip51)
  • Promoter T5 promoter
  • Tag / Fusion Protein
    • His tag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer pQTEV3_F, 5’- TATAAAAATAGGCGTATCACGAGG -3’
  • 3′ sequencing primer pQTEV3_R, 3’- CCAGTGATTTTTTTCTCCATTTT -5’
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pQlinkH-PTPIP51(236-470) was a gift from Byung Il Lee (Addgene plasmid # 170530 ; http://n2t.net/addgene:170530 ; RRID:Addgene_170530)
  • For your References section:

    Phospholipid transfer function of PTPIP51 at mitochondria-associated ER membranes. Yeo HK, Park TH, Kim HY, Jang H, Lee J, Hwang GS, Ryu SE, Park SH, Song HK, Ban HS, Yoon HJ, Lee BI. EMBO Rep. 2021 Jun 4;22(6):e51323. doi: 10.15252/embr.202051323. Epub 2021 May 2. 10.15252/embr.202051323 PubMed 33938112