pLV.5’eGFP/sgVIM
              
              
                (Plasmid
                
                #170548)
              
            
            
            
          - 
            PurposeExpresses a sgRNA for 5' tagging to VIM and contains a cassette with eGFP without homology arms
 - 
              Depositing Lab
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 170548 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepLV_eGFP-U6-sgRNA
 - Backbone size w/o insert (bp) 9046
 - Total vector size (bp) 9046
 - 
              Vector typeLentiviral, CRISPR
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)NEB Stable
 - 
            Copy numberHigh Copy
 
Gene/Insert
- 
                Gene/Insert namesgRNA targeting 5'- end of VIM
 - 
                  Insert Size (bp)20
 - 
                    GenBank ID
 - Promoter U6
 
Cloning Information
- Cloning method Unknown
 - 5′ sequencing primer GAGGGCCTATTTCCCATGAT
 - 3′ sequencing primer GTCCCTGTAATAAACCCGAA (Common Sequencing Primers)
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
pLV.5’eGFP/sgVIM was a gift from Jacob Giehm Mikkelsen (Addgene plasmid # 170548 ; http://n2t.net/addgene:170548 ; RRID:Addgene_170548) - 
                
For your References section:
CRISPR-Cas9-directed gene tagging using a single integrase-defective lentiviral vector carrying a transposase-based Cas9 off switch. Thomsen EA, Skipper KA, Andersen S, Haslund D, Skov TW, Mikkelsen JG. Mol Ther Nucleic Acids. 2022 Aug 4;29:563-576. doi: 10.1016/j.omtn.2022.08.005. eCollection 2022 Sep 13. 10.1016/j.omtn.2022.08.005 PubMed 36090759