Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLV.5’eGFP/sgVIM
(Plasmid #170548)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 170548 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLV_eGFP-U6-sgRNA
  • Backbone size w/o insert (bp) 9046
  • Total vector size (bp) 9046
  • Vector type
    Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA targeting 5'- end of VIM
  • Insert Size (bp)
    20
  • GenBank ID
  • Promoter U6

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GAGGGCCTATTTCCCATGAT
  • 3′ sequencing primer GTCCCTGTAATAAACCCGAA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV.5’eGFP/sgVIM was a gift from Jacob Giehm Mikkelsen (Addgene plasmid # 170548 ; http://n2t.net/addgene:170548 ; RRID:Addgene_170548)
  • For your References section:

    CRISPR-Cas9-directed gene tagging using a single integrase-defective lentiviral vector carrying a transposase-based Cas9 off switch. Thomsen EA, Skipper KA, Andersen S, Haslund D, Skov TW, Mikkelsen JG. Mol Ther Nucleic Acids. 2022 Aug 4;29:563-576. doi: 10.1016/j.omtn.2022.08.005. eCollection 2022 Sep 13. 10.1016/j.omtn.2022.08.005 PubMed 36090759