Skip to main content
Addgene

pRSFDuet1-His-TEV-OTC_d1_Ub
(Plasmid #170729)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 170729 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRSFDuet1-6xHis-TEV
  • Backbone manufacturer
    Novagen (+ 6xHis-TEV in-house modification)
  • Backbone size w/o insert (bp) 3810
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    E. coli ornithine transcarbamylase (OTC), fused to human ubiquitin
  • Species
    H. sapiens (human); E. coli
  • Insert Size (bp)
    1299
  • Mutation
    The C-terminus of OTC was truncated by removing one amino acid.
  • Promoter T7
  • Tag / Fusion Protein
    • 6xHis-TEV (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer CCCTGTAGAAATAATTTTGTTTAAC
  • 3′ sequencing primer GATTATGCGGCCGTGTACAA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRSFDuet1-His-TEV-OTC_d1_Ub was a gift from Shang-Te Danny Hsu (Addgene plasmid # 170729 ; http://n2t.net/addgene:170729 ; RRID:Addgene_170729)
  • For your References section:

    Direct Visualization of a 26 kDa Protein by Cryo-Electron Microscopy Aided by a Small Scaffold Protein. Chiu YH, Ko KT, Yang TJ, Wu KP, Ho MR, Draczkowski P, Hsu SD. Biochemistry. 2021 Apr 13;60(14):1075-1079. doi: 10.1021/acs.biochem.0c00961. Epub 2021 Mar 15. 10.1021/acs.biochem.0c00961 PubMed 33719392