Skip to main content
Addgene

pJC8
(Plasmid #170757)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 170757 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pJC8
  • Backbone size (bp) 5159
  • Vector type
    Mammalian Expression
  • Promoter CMV
  • Tags / Fusion Proteins
    • site 1- V5 tag (C terminal on backbone)
    • site 2- FLAG tag (C terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer site 2- IRES for: ggtgcacatgctttacgtgt
  • 3′ sequencing primer site 2- WPRE rev: atccacatagcgtaaaaggagc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Additional primers for Site 1 are provided below:

5’ seq primer: site 1- CMV for: CGCAAATGGGCGGTAGGCGTG
3’ seq primer: site 1- IRES rev: acaccggccttattccaag

Please visit https://www.biorxiv.org/content/10.1101/2021.04.05.438513v2 for BioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJC8 was a gift from Roberto Dominguez (Addgene plasmid # 170757 ; http://n2t.net/addgene:170757 ; RRID:Addgene_170757)
  • For your References section:

    Novel human cell expression method reveals the role and prevalence of posttranslational modification in nonmuscle tropomyosins. Carman PJ, Barrie KR, Dominguez R. J Biol Chem. 2021 Oct;297(4):101154. doi: 10.1016/j.jbc.2021.101154. Epub 2021 Sep 1. 10.1016/j.jbc.2021.101154 PubMed 34478714