pJC8
(Plasmid
#170757)
-
Purpose(Empty Backbone) Co-express in mammalian cells two target proteins C-terminally fused to V5 and FLAG tags respectively, using an internal ribosome entry site and two multi-cloning sites.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 170757 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepJC8
- Backbone size (bp) 5159
-
Vector typeMammalian Expression
- Promoter CMV
-
Tags
/ Fusion Proteins
- site 1- V5 tag (C terminal on backbone)
- site 2- FLAG tag (C terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer site 2- IRES for: ggtgcacatgctttacgtgt
- 3′ sequencing primer site 2- WPRE rev: atccacatagcgtaaaaggagc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Additional primers for Site 1 are provided below:
5’ seq primer: site 1- CMV for: CGCAAATGGGCGGTAGGCGTG
3’ seq primer: site 1- IRES rev: acaccggccttattccaag
Please visit https://www.biorxiv.org/content/10.1101/2021.04.05.438513v2 for BioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJC8 was a gift from Roberto Dominguez (Addgene plasmid # 170757 ; http://n2t.net/addgene:170757 ; RRID:Addgene_170757) -
For your References section:
Novel human cell expression method reveals the role and prevalence of posttranslational modification in nonmuscle tropomyosins. Carman PJ, Barrie KR, Dominguez R. J Biol Chem. 2021 Oct;297(4):101154. doi: 10.1016/j.jbc.2021.101154. Epub 2021 Sep 1. 10.1016/j.jbc.2021.101154 PubMed 34478714