Skip to main content

pE5771
(Plasmid #170778)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 170778 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET plus custom insert
  • Backbone size w/o insert (bp) 3865
  • Total vector size (bp) 5013
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Kan resistance
  • Alt name
    KanR
  • Entrez Gene
    kanR (a.k.a. peH4H_0130)
  • Promoter T7
  • Tag / Fusion Protein
    • polyhisTEVSBPTEV (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamH1 (not destroyed)
  • 3′ cloning site Xba1/HindIII (not destroyed)
  • 5′ sequencing primer taatacgactcactataggg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pE5771 was a gift from Anthony Schryvers (Addgene plasmid # 170778 ; http://n2t.net/addgene:170778 ; RRID:Addgene_170778)
  • For your References section:

    Design and Production of Hybrid Antigens for Targeting Integral Outer Membrane Proteins in Gram-Negative Bacteria. Chaudhuri S, Ewasechko NF, Samaniego-Barron L, Fegan JE, Schryvers AB. Methods Mol Biol. 2022;2414:115-140. doi: 10.1007/978-1-0716-1900-1_8. 10.1007/978-1-0716-1900-1_8 PubMed 34784035