pE5771
(Plasmid
#170778)
-
Purposeproduction of tagged outer membrane protein
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 170778 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET plus custom insert
- Backbone size w/o insert (bp) 3865
- Total vector size (bp) 5013
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameKan resistance
-
Alt nameKanR
-
Entrez GenekanR (a.k.a. peH4H_0130)
- Promoter T7
-
Tag
/ Fusion Protein
- polyhisTEVSBPTEV (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamH1 (not destroyed)
- 3′ cloning site Xba1/HindIII (not destroyed)
- 5′ sequencing primer taatacgactcactataggg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pE5771 was a gift from Anthony Schryvers (Addgene plasmid # 170778 ; http://n2t.net/addgene:170778 ; RRID:Addgene_170778) -
For your References section:
Design and Production of Hybrid Antigens for Targeting Integral Outer Membrane Proteins in Gram-Negative Bacteria. Chaudhuri S, Ewasechko NF, Samaniego-Barron L, Fegan JE, Schryvers AB. Methods Mol Biol. 2022;2414:115-140. doi: 10.1007/978-1-0716-1900-1_8. 10.1007/978-1-0716-1900-1_8 PubMed 34784035