pUASTattB-2xFlag-mCherry-Msp300KASH
(Plasmid
#170807)
-
PurposeExpresses Msp300 KASH domain fused to 2xFLAG and mCherry under Gal4/UAS control for Drosophila transgenesis
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 170807 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUASTattB
- Backbone size w/o insert (bp) 9355
- Total vector size (bp) 10312
-
Vector typeInsect Expression
-
Selectable markersmini-white
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name2xFLAG/mCherry-Msp300KASH
-
SpeciesD. melanogaster (fly)
-
Insert Size (bp)957
- Promoter 5xUAS + hsp70 minimal promoter
-
Tags
/ Fusion Proteins
- 2xFLAG-mCherry (C terminal on insert)
- Msp300KASH
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer CAACTGCAACTACTGAAATCTGCC
- 3′ sequencing primer ggcattccaccactgctccc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Plasmid first described in:
Hall H., Medina P., Cooper D.A., Escobedo S.E., Rounds J., Brennan K.J., Vincent C., Miura P., Doerge R. and Weake V.M. (2017). Transcriptome profiling of aging Drosophila photoreceptors reveals gene expression trends that correlate with visual senescence. BMC Genomics. 18(1):894. PMID: 29162050.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUASTattB-2xFlag-mCherry-Msp300KASH was a gift from Vikki Weake (Addgene plasmid # 170807 ; http://n2t.net/addgene:170807 ; RRID:Addgene_170807) -
For your References section:
In vivo tissue-specific chromatin profiling in Drosophila melanogaster using GFP-tagged nuclei. Jauregui-Lozano J, Bakhle K, Weake VM. Genetics. 2021 May 22. pii: 6281219. doi: 10.1093/genetics/iyab079. 10.1093/genetics/iyab079 PubMed 34022041