pUASTattB-2xFlag-mCherry-Msp300KASH
(Plasmid #170807)

• Purpose: Expresses Msp300 KASH domain fused to 2xFLAG and mCherry under Gal4/UAS control for Drosophila transgenesis
• Depositing Lab: Vikki Weake
• Publication: Jauregui-Lozano et al Genetics. 2021 May 22. pii: 6281219. doi: 10.1093/genetics/iyab079.

Backbone

• Vector backbone: pUASTattB
• Backbone size w/o insert (bp): 9355
• Total vector size (bp): 10312
• Vector type: Insect Expression
• Selectable markers: mini-white

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: 2xFLAG/mCherry-Msp300KASH
• Species: D. melanogaster (fly)
• Insert Size (bp): 957
• Promoter: 5xUAS + hsp70 minimal promoter
• Tags / Fusion Proteins:
  • 2xFLAG-mCherry (C terminal on insert)
  • Msp300KASH

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: CAACTGCAACTACTGAAATCTGCC
• 3′ sequencing primer: ggcattccaccactgctccc

Resource Information

• Supplemental Documents:
  • pUASTattB-2xFlag-mCherry-Msp300KASH.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Plasmid first described in:
Hall H., Medina P., Cooper D.A., Escobedo S.E., Rounds J., Brennan K.J., Vincent C., Miura P., Doerge R. and Weake V.M. (2017). Transcriptome profiling of aging Drosophila photoreceptors reveals gene expression trends that correlate with visual senescence. BMC Genomics. 18(1):894. PMID: 29162050.