AAVS1-Puro CAG eGFP NLS
(Plasmid
#170830)
-
PurposeDonor plasmid for knocking eGFP NLS into AAVS1 safe harbor locus
-
Depositing Lab
-
Depositing OrganizationPurdue University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 170830 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 170830-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 170830-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneAAVS1-Puro CAG FUCCI (Addgene #136934)
- Backbone size w/o insert (bp) 10228
- Total vector size (bp) 11738
-
Vector typeMammalian Expression, CRISPR, TALEN, Synthetic Biology
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameeGFP
-
SpeciesSynthetic
-
Insert Size (bp)789
- Promoter CAG
-
Tag
/ Fusion Protein
- NLS (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site MluI (not destroyed)
- 5′ sequencing primer gctaaccatgttcatgccttc
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 170830-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 170830-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAVS1-Puro CAG eGFP NLS was a gift from Xiaoping Bao (Addgene plasmid # 170830 ; http://n2t.net/addgene:170830 ; RRID:Addgene_170830) -
For your References section:
Engineering chimeric antigen receptor neutrophils from human pluripotent stem cells for targeted cancer immunotherapy. Chang Y, Syahirah R, Wang X, Jin G, Torregrosa-Allen S, Elzey BD, Hummel SN, Wang T, Li C, Lian X, Deng Q, Broxmeyer HE, Bao X. Cell Rep. 2022 Jul 19;40(3):111128. doi: 10.1016/j.celrep.2022.111128. 10.1016/j.celrep.2022.111128 PubMed 35858579
Map uploaded by the depositor.
