pYI047
(Plasmid
#170843)
-
Purpose(pFRO6::SMT2-FLAG::tOCS)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 170843 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepYI001
-
Vector typePlant Expression
Growth in Bacteria
-
Bacterial Resistance(s)Streptomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepFRO6::SMT2-FLAG
- Promoter FRO6p
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer - (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that the Addgene verified sequence differs from the depositor reference sequence linked in the supplemental documents section. These differences did not impact plasmid function. The primers 5' - ATCCAAGCTCAAGCTAAGCTcgatgctctcaaggccaa and 3' -TATCTCATTAAAGCAGGATCCTCACTTGTCATCGTCGTCCTTGTAATCAGAACTCTCCTCCGGT were previously used, although the 5' primer differs slightly from the Addgene verified sequence.
Please visit https://doi.org/10.1101/2021.06.16.448628 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pYI047 was a gift from Christian Fankhauser (Addgene plasmid # 170843 ; http://n2t.net/addgene:170843 ; RRID:Addgene_170843) -
For your References section:
A combination of plasma membrane sterol biosynthesis and autophagy is required for shade-induced hypocotyl elongation. Ince YC, Krahmer J, Fiorucci AS, Trevisan M, Galvao VC, Wigger L, Pradervand S, Fouillen L, Van Delft P, Genva M, Mongrand S, Gallart-Ayala H, Ivanisevic J, Fankhauser C. Nat Commun. 2022 Oct 10;13(1):5659. doi: 10.1038/s41467-022-33384-9. 10.1038/s41467-022-33384-9 PubMed 36216814