Skip to main content
Addgene

pGREAT14
(Plasmid #170902)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 170902 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pDGB1_omega1
  • Backbone manufacturer
    Diego Orzaez Lab
  • Backbone size w/o insert (bp) 2925
  • Vector type
    Plant Expression, Luciferase, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    E-Luc
  • Alt name
    Enhanced beetle luciferase
  • Species
    Pyrearinus termitilluminans (E-Luc) and Luciola curciata (Red-F)
  • Insert Size (bp)
    4990
  • Mutation
    c.375C>T silent mutation to remove BbsI site (E-Luc), p.S286Y Red mutant (RedF)
  • Promoter pG10-90

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Esp3I (destroyed during cloning)
  • 3′ cloning site Esp3I (destroyed during cloning)
  • 5′ sequencing primer GGGAAACGCCTGGTATCTTT
  • 3′ sequencing primer CCGATCCCCGGAATTAGATC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Encodes both E-Luc and Red-F transcriptional units. Insert can be excised by BsaI digestion. Requires pSOUP for replication in agrobacterium . Please visit https://www.biorxiv.org/content/10.1101/2021.05.26.443018v2 to read the preprint on bioRxiv

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGREAT14 was a gift from Markita Landry (Addgene plasmid # 170902 ; http://n2t.net/addgene:170902 ; RRID:Addgene_170902)
  • For your References section:

    A Ratiometric Dual Color Luciferase Reporter for Fast Characterization of Transcriptional Regulatory Elements in Plants. Gonzalez-Grandio E, Demirer GS, Ma W, Brady S, Landry MP. ACS Synth Biol. 2021 Sep 14. doi: 10.1021/acssynbio.1c00248. 10.1021/acssynbio.1c00248 PubMed 34520169