Skip to main content

pMSCV_PIG_3XHA-Ago1
(Plasmid #170916)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 170916 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMSCV-PIG
  • Backbone manufacturer
    David Bartel Lab (Addgene #21654)
  • Backbone size w/o insert (bp) 7675
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin ; EGFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Ago1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2667
  • Entrez Gene
    Ago1 (a.k.a. Eif2c, Eif2c1)
  • Tag / Fusion Protein
    • 3X-HA (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer pMSCV_Fw: cccttgaacctcctcgttcgacc
  • 3′ sequencing primer pMSCV_Rv: cagcggggctgctaaagcgcatgc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMSCV_PIG_3XHA-Ago1 was a gift from Constance Ciaudo (Addgene plasmid # 170916 ; http://n2t.net/addgene:170916 ; RRID:Addgene_170916)
  • For your References section:

    AGO1 regulates pericentromeric regions in mouse embryonic stem cells. Muller M, Fah T, Schaefer M, Hermes V, Luitz J, Stalder P, Arora R, Ngondo RP, Ciaudo C. Life Sci Alliance. 2022 Mar 2;5(6). pii: 5/6/e202101277. doi: 10.26508/lsa.202101277. Print 2022 Jun. 10.26508/lsa.202101277 PubMed 35236760