pMSCV_PIG_3XHA-Ago1
(Plasmid
#170916)
-
PurposeExpresses 3X-HA-AGO1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 170916 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMSCV-PIG
-
Backbone manufacturerDavid Bartel Lab (Addgene #21654)
- Backbone size w/o insert (bp) 7675
-
Vector typeMammalian Expression
-
Selectable markersPuromycin ; EGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAgo1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2667
-
Entrez GeneAgo1 (a.k.a. Eif2c, Eif2c1)
-
Tag
/ Fusion Protein
- 3X-HA (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer pMSCV_Fw: cccttgaacctcctcgttcgacc
- 3′ sequencing primer pMSCV_Rv: cagcggggctgctaaagcgcatgc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMSCV_PIG_3XHA-Ago1 was a gift from Constance Ciaudo (Addgene plasmid # 170916 ; http://n2t.net/addgene:170916 ; RRID:Addgene_170916) -
For your References section:
AGO1 regulates pericentromeric regions in mouse embryonic stem cells. Muller M, Fah T, Schaefer M, Hermes V, Luitz J, Stalder P, Arora R, Ngondo RP, Ciaudo C. Life Sci Alliance. 2022 Mar 2;5(6). pii: 5/6/e202101277. doi: 10.26508/lsa.202101277. Print 2022 Jun. 10.26508/lsa.202101277 PubMed 35236760