EF1A_Hygro_P2A_RUNX1_E111V_Barcode
(Plasmid
#170963)
-
PurposeOverexpression of RUNX1 E111V mutant protein.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 170963 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneEF1a_mCherry_P2A_Hygro_Barcode
-
Backbone manufacturerPrashant Mali (Addgene #120426)
- Backbone size w/o insert (bp) 9508
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRUNX1
-
Alt nameAML1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1359
-
MutationE111V
-
Entrez GeneRUNX1 (a.k.a. AML1, AML1-EVI-1, AMLCR1, CBF2alpha, CBFA2, EVI-1, PEBP2aB, PEBP2alpha)
- Promoter Ef1A
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTGTGTAGAAGTACTCGCCGATAGTG
- 3′ sequencing primer TCTTGTCTTCGTTGGGAGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.08.03.551876 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EF1A_Hygro_P2A_RUNX1_E111V_Barcode was a gift from Prashant Mali (Addgene plasmid # 170963 ; http://n2t.net/addgene:170963 ; RRID:Addgene_170963) -
For your References section:
Interface-guided phenotyping of coding variants in the transcription factor RUNX1. Ozturk K, Panwala R, Sheen J, Ford K, Jayne N, Portell A, Zhang DE, Hutter S, Haferlach T, Ideker T, Mali P, Carter H. Cell Rep. 2024 Jul 4;43(7):114436. doi: 10.1016/j.celrep.2024.114436. 10.1016/j.celrep.2024.114436 PubMed 38968069