Skip to main content

pUCSh3-2300
(Plasmid #170985)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 170985 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC
  • Backbone size w/o insert (bp) 5218
  • Total vector size (bp) 5242
  • Vector type
    Bacterial Expression, CRISPR, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin and Tetracycline, 100 & 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Sh-CAST sgRNA 2300
  • gRNA/shRNA sequence
    ggggtagcgggcgaagcactgcag
  • Promoter J23119

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer ggggttccgcgcacatttc
  • 3′ sequencing primer caacgctgatgggtcacgac
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Addgene plasmid #127924 - pDonor_ShCAST_kanR

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUCSh3-2300 was a gift from Christopher Reisch (Addgene plasmid # 170985 ; http://n2t.net/addgene:170985 ; RRID:Addgene_170985)
  • For your References section:

    CRISPR-Associated Transposase for Targeted Mutagenesis in Diverse Proteobacteria. Trujillo Rodriguez L, Ellington AJ, Reisch CR, Chevrette MG. ACS Synth Biol. 2023 Jun 27. doi: 10.1021/acssynbio.3c00065. 10.1021/acssynbio.3c00065 PubMed 37368499